Skip to content

16S Metabarcoding for mammals and birds (meat products)

Description

💡 Sequencing parameters:

  • Platform: Illumina, IonTorrent and Nanopore
  • Read-length: Illumina 2x150bp, single-end with 150bp or longer
  • Targets: mammals, birds

🎓 Relevant publications:

📜 Official Methods:

  • Illumina, Iontorrent: Amtliche Sammlung von Untersuchungsverfahren: BVL L 00.00-184 (German)

⚙ Run with:

--primer_set 16S_ILM_ASU184_meat (Illumina)

--primer_set 16S_IT_ASU184_meat (Iontorrent)

--primer_set 16S_ONT_ASU184_meat (Nanopore)

For example:

nextflow run bio-raum/FooDMe2 \
  -r main \
  -profile myprofile \ # (1)!
  --input samples.tsv \
  --primer_set 16S_ILM_ASU184_meat
  1. See the installation guide for more details on this parameter

Primer sequence(s)

The following primer sequences are used:

>MA_FWD
GACGAGAAGACCCTATGGAGC
>MA_REV
TCCGAGGTCACCCCAACC
>POL_FWD
GACGAGAAGACCCTGTGGAAC
>POL_REV
TCCGAGATCACCCCAATC
>MA_ALT_REV
TCCAAGGTCGCCCCAACC

Configuration

Check the relevant configuration file under conf/primers/ for an list of parameters (e.g. 16S_ILM_ASU184_meat.conf).

Validation

Mammals and birds 16S Illumina metabarcoding, method from Dobrovolny paper with the dataset from the FooDMe1 paper.

For this method, a benchmarking (or validation) profile is provided in the FooDMe2 distribution:

nextflow run bio-raum/FooDMe2 \
  -profile singularity,dobrovolny_benchmark \
  -r main

Running this will fetch the dataset from ENA, run the workflow with the 16S_ILM_ASU188_meat preconfiguration and then compare the resutls to the expected composition defined under assets/validation/dobrovolny_benchmark_groundtruth.csv. A noise filter fo 0.1% of the total read number is applied to each sample and the composition is matched to up to the genus level.

In the resulting Excel file we can quickly count the number of TP, FP and FN and calculate precision and recall for the analysis:

- Expect Positive Expect negative
Predicted Positive 524 31
Predicted Negative 19 -

Which means a precision of 94.4% and recall of 96.5% out of the box.

However there are 14 FN occurences of fallow deer (Dama dama) in the table, which was not amplified in the initial method and therefore cannot be detected. These can be ignored for the validation.

Another problem in this dataset is that Kangaroo (Macropodidae), a family node, was expected with no information on the species, this results in a negative results in the benchmarking tools. We can correct this be converting all FP results for Kangaroo into FP (if a kangaroo speice was detected of course), these are all 17 occurences where either of Macropus giganteus, Osphranter robusuts, or Osphranter rufus were detected.

The corrected confusion table now looks like this:

- Expect Positive Expect negative
Predicted Positive 541 14
Predicted Negative 5 -

Now resulting in a precision of 97.4% and a recall of 99.1%.