CYTB Metabarcoding for fish species (ASU12)

Description

Sequencing parameters:

• Platform: Illumina, IonTorrent and Nanopore
• Read-length: paired-end 250bp or longer, single-end with 450bp or longer
• Targets: fish

Relevant publications:

• Untersuchung von Lebensmitteln - DNA-Barcoding zur Fischartidentifizierung in Fisch und Fischerzeugnissen anhand definierter mitochondrialer Cytochrom-b- und Cytochrom-c-Oxidase-I-Genabschnitte

Official Methods:

• Untersuchung von Lebensmitteln - DNA-Barcoding zur Fischartidentifizierung in Fisch und Fischerzeugnissen anhand definierter mitochondrialer Cytochrom-b- und Cytochrom-c-Oxidase-I-Genabschnitte

Run with:

--primer_set cytb_ILM_ASU12_fish (Illumina)

--primer_set cytb_IT_ASU12_fish (Iontorrent)

--primer_set cytb_ONT_ASU12_fish (Nanopore)

For example:

nextflow run bio-raum/FooDMe2 \
  -r main \
  -profile myprofile \ # (1)!
  --input samples.tsv \
  --primer_set cytb_ILM_ASU12_fish

1. See the installation guide for more details on this parameter

Primer sequence(s)

The following primer sequences are used:

>L14735
AAAAACCACCGTTGTTATTCAACTA
>H15149ad
GCNCCTCARAATGAYATTTGTCCTCA

Configuration

Check the relevant configuration file under conf/primers/ for an list of parameters (e.g. cytb_ILM_ASU12_fish.conf).