16S Metabarcoding for fish (Dobrovolny et al.)

Description

Sequencing parameters:

• Platform: Illumina, IonTorrent and Nanopore
• Read-length: paired-end 150bp or longer, single-end with 150bp or longer
• Targets: fish

Relevant publications:

• Development of a DNA metabarcoding method for the identification of fifteen mammalian and six poultry species in food
• Identification of Mammalian and Poultry Species in Food and Pet Food Samples Using 16S rDNA Metabarcoding

Official Methods:

!!!This system is used in an official method for mammals and birds, but not for fish species!!!

• Illumina, Iontorrent: Amtliche Sammlung von Untersuchungsverfahren: BVL L 00.00-184 (German)

Run with:

--primer_set 16S_ILM_ASU184_fish (Illumina)

--primer_set 16S_IT_ASU184_fish (Iontorrent)

--primer_set 16S_ONT_ASU184_fish (Nanopore)

For example:

nextflow run bio-raum/FooDMe2 \
  -r main \
  -profile myprofile \ # (1)!
  --input samples.tsv \
  --primer_set 16S_ILM_ASU184_fish

1. See the installation guide for more details on this parameter

Primer sequence(s)

The following primer sequences are used:

>MA_FWD
GACGAGAAGACCCTATGGAGC
>MA_REV
TCCGAGGTCACCCCAACC
>POL_FWD
GACGAGAAGACCCTGTGGAAC
>POL_REV
TCCGAGATCACCCCAATC
>MA_ALT_REV
TCCAAGGTCGCCCCAACC

Configuration

Check the relevant configuration file under conf/primers/ for an list of parameters (e.g. 16S_ILM_ASU184_fish.conf).