trnL barcode for plants

Description

Sequencing parameters:

• Platform: Illumina
• Read-length: paired-end 150bp
• Targets: plants

Relevant publications:

• Taberlet P., Gielly L., Pautou G., Bouvet J. (1991) Universal primers for amplification of three non-coding regions of chloroplast DNA.
• Eine universell einsetzbare PCR-Methode zur Pflanzenartbestimmung von Lebensmitteln: Erfahrungen und Möglichkeiten.

Official Methods:

• Not currently an official method.

Run with:

--primer_set trnLlong_ILM_Taberlet_plants (Illumina)

For example:

nextflow run bio-raum/FooDMe2 \
  -r main \
  -profile myprofile \ # (1)!
  --input samples.tsv \
  --primer_set trnLlong_ILM_Taberlet_plants

1. See the installation guide for more details on this parameter

Primer sequence(s)

The following primer sequences are used:

>CLP1a
TAGGTGCAGAGACTCAATGG
>CLP2
GGGGATAGAGGGACTTGAAC

Configuration

Check the relevant configuration file under conf/primers/ for an list of parameters (e.g. trnLlong_ILM_Taberlet_plants.conf).